A colony of C/EBPβ+/- mice 19 on a C57BL/6-129 S6/SvEv background was used to obtain C/EBPβ+/+ and C/EBPβ-/- mixed glial cultures as previously described by Straccia et al.18. Experiments were carried out in accordance with the Guidelines of the European Union Council (86/609/EU) and following the Spanish regulations (BOE 67/8509-12, 1988) for the use of laboratory animals, and were approved by the Ethics and Scientific Committees of Barcelona University and the Hospital Clínic de Barcelona.

Mixed glial cultures were obtained from pools of cerebral cortices of two- to four-day-old C57BL/6 wild-type mice as described by Gresa-Arribas et al. 20. In the experiments with C/EBPβ-deficient mice, C/EBPβ+/+ and C/EBPβ-/- mixed glial cultures were obtained from single 19-day-old embryos from C/EBPβ+/- progenitors as described by Straccia et al. 18, due to the infertility of C/EBPβ-/- females and a perinatal death rate of approximately 50% for C/EBPβ-/- neonates. The culture medium consisted of Dulbecco’s modified Eagle medium (DMEM)/F-12 nutrient mixture (Invitrogen, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS, Invitrogen), 0.1% penicillin-streptomycin (Invitrogen), and 0.5 mg/mL amphotericin B (Fungizone®, Invitrogen). Cells were maintained at 37°C in a 5% CO₂ humidified atmosphere. Medium was replaced every five to sevendays.

Microglial cultures were prepared from 19 to 21 days in vitro (DIV) mixed glial cultures using the mild trypsinization method as previously described by our group 21. Briefly, the cultures were treated for 30 minutes with 0.06% trypsin in the presence of 0.25 mM ethylenediamine tetraacetic acid (EDTA) and 0.5 mM Ca²⁺. This resulted in the detachment of an intact layer of cells containing virtually all the astrocytes, leaving a population of firmly attached cells identified as >98% microglia. The microglial cultures were used 24 hours after isolation. Flow cytometry studies, qRT-PCR assays, quantitative chromatin immunoprecipitation (qChIP) and co-immunoprecipitation experiments were performed using primary mixed glial cultures due to the limited amount of primary microglial cells usually obtained.

Astroglia-enriched cultures were obtained as described by Saura et al. 22.

The mouse microglial cell line BV2 (generated from primary mouse microglia transfected with a v-raf/v-myc oncogene, Blasi et al. 23) was kindly provided by Dr. Elisabetta Blasi (Dip. Scienze Igienistiche, Microbiologiche e Biostatistiche, Modena, Italy). Cells were cultured in Roswell Park Memorial Institute (RPMI)-1640 medium (Invitrogen), supplemented with 0.1% penicillin-streptomycin (Invitrogen) and 10% heat-inactivated FBS. Cells were maintained at 37°C in a 5% CO₂ humidified atmosphere. Stable clones overexpressing the C/EBPβ LAP isoform were obtained. Briefly, BV2 cells were transfected with 1 μg pCDNA (empty vector) or pCDNA-LAP expression plasmids (Dr. Steven Smale, UCLA, USA) using Lipofectamine 2000 (Invitrogen). Positive clones were selected with Zeocin™ (150 μg/mL) (Invitrogen) associated resistance. Cells were seeded at a density of 5 × 10⁴ cells/mL (1.6 × 10⁴ cells/cm²) for immunocytochemistry and at 10⁵ cells/mL (2.4 × 10⁶ cells/cm²) for protein and RNA extraction. One day after seeding, the culture medium was replaced with fresh RPMI medium, and the cells were used one day later.

Cells were exposed to 100 ng/mL LPS from Escherichia coli (026:B6, Sigma-Aldrich, St. Louis, MO, USA) for different lengths of time.

The HDAC inhibitors suberoylanilide hydroxamic acid (SAHA) and MS-275 (Cayman Chemicals, Ann Arbor, MI, USA) were used at 100 nM, 500 nM, 1 μM and 10 μM. They were added to the cultures one hour before LPS treatment.

Cultured cells were fixed with 4% paraformaldehyde in 0.1 M phosphate buffer (pH 7.4) for 20 minutes at room temperature. Non-specific staining was blocked by incubating cells with 10% normal donkey serum (Vector, Peterborough, UK) in PBS containing 1% BSA for 20 minutes at room temperature. Cells were then incubated overnight at 4°C with polyclonal goat anti-CD200R1 (1:50, R&D, Abingdon, UK), alone or in combination (mixed glial cultures) with monoclonal rat anti-CD11b (1:200, Serotec, Oxford, UK) or polyclonal rabbit anti-GFAP (1:1000, DAKO, Glostrub, DK) primary antibodies. After rinsing in PBS, cells were incubated for one hour at room temperature with donkey anti-goat ALEXA 488 (1:500) or ALEXA 594 (1:500), alone or in combination with donkey anti-rat ALEXA 594 (1:500) or donkey anti-rabbit ALEXA 546 (1:1000) secondary antibodies (Molecular Probes, Eugene, OR, USA). In the case of mixed glial cultures, cells were permeated with 0.3% Triton X-100 in PBS containing 1% BSA and 10% normal donkey serum for 20 minutes at room temperature following fixation. Cell nuclei were stained with Hoechst 33258 (Sigma). Microscopy images were obtained with an Olympus IX70 microscope (Olympus, Okoya, Japan) and a digital camera (CC-12, Olympus Soft Imaging Solutions GmbH, Hamburg, Germany).

Total protein extracts were obtained from mixed glial cultures and BV2 cells. One well on a six-well plate was used for each experimental condition. After a cold PBS wash, cells were scraped off and recovered in 100 μL of radioimmunoprecipitation assay (RIPA) buffer per well (1% Igepal CA-630, 5 mg/mL sodium deoxycholate, 1 mg/mL SDS, protease inhibitor cocktail Complete® -Roche Diagnostics, Mannheim, Germany- in PBS). Samples were sonicated, centrifuged for five minutes at 10,400 g and stored at -20°C. The amount of protein was determined using the Lowry assay (Total protein kit micro-Lowry, Sigma-Aldrich).

Total protein extracts (50 μg) or immunoprecipitated samples were denatured (120 mM Tris HCl pH 6.8, 10% glycerol, 3% SDS, 20 mM dithiothreitol (DTT), and 0.4% bromophenol blue, 100°C for five minutes) and subjected to SDS-PAGE on a 10% polyacrylamide minigel, together with a molecular weight marker (Fullrange Rainbow Molecular Weight Marker, GE Healthcare, Little Chalfont, UK), and transferred to a polyvinylidene fluoride (PVDF) membrane (Millipore, Bedford, MA, USA) for 90 minutes at 1 mA/cm². The detection of the proteins of interest was performed as described by Gresa-Arribas et al. 20. Monoclonal mouse anti-C/EBPβ (1:500, Abcam, Cambridge, UK) and monoclonal mouse anti-β-actin (1:50000, Sigma-Aldrich) were used as primary antibodies. Horseradish peroxidase-labelled goat anti-mouse was used as the secondary antibody (1:5000, Santa Cruz Biotechnology, Temecula, CA, USA). The signal was developed with ECL-Plus (GE) and images were obtained using a VersaDoc System (Bio-Rad Laboratories, Hercules, CA, USA). The pixel intensities of the immunoreactive bands were quantified using the % adjusted volume feature of Quantity One 5.4.1 software (Bio-Rad Laboratories). Data are expressed as the ratio between the intensity of the C/EBPβ band and the loading control protein band (β-actin).

CD200R1 and C/EBPβ mRNA expression was determined in primary glial cultures and BV2 cells six hours after treatments. For isolation of total RNA, one well from six-well culture plates was used per experimental condition, with the exception of primary microglial cultures, where one 75 cm² flask was considered. Total RNA was isolated using a High Pure RNA Isolation Kit (Roche Diagnostics) and 1.5 μg of RNA for each condition was reverse transcribed with random primers using Transcriptor Reverse Transcriptase (Roche Diagnostics). Three nanograms of cDNA were used to perform quantitative real-time PCR. The following primers (Integrated DNA Technology, IDT) were used: 5′-AGGAGGATGAAATGCAGCCTTA-3′ (Forward) and 5′-TGCCTCCACCTTAGTCACAGTATC-3′ (Reverse) to amplify mouse CD200R1 mRNA; 5′-AAGCTGAGCGACGAGTACAAGA-3′ (Forward) and 5′-GTCAGCTCCAGCACCTTGTG-3′ (Reverse) for mouse C/EBPβ. For the normalization of cycle threshold (Ct) values to an endogenous control, the following primers were used: 5′-CAACGAGCGGTTCCGATG-3′ (Forward) and 5′-GCCACAGGATTCCATACCCA-3′ (Reverse) for mouse β-actin mRNA and 5′-GTAACCCGTTGAACCCCATT-3′ (Forward) and CCATCCAATCGGTAGTAGCG (Reverse) for mouse Rn18s mRNA; β-actin and Rn18s mRNA levels were not altered by cell treatment. Real-time PCR was carried out using the IQ SYBR Green SuperMix (Bio-Rad Laboratories) in 15 μL of final volume using an iCycler MyIQ apparatus (Bio-Rad Laboratories). Samples were run for 50 cycles (95°C for 15 seconds, 60°C for 30 seconds, and 72°C for 15 seconds). Relative gene expression values were calculated using the comparative Ct or ΔΔCt method 24 and iQ5 2.0 software (Bio-Rad Laboratories). Ct values were corrected according to the amplification efficiency of the respective primer pair which was estimated from standard curves generated by dilution of a cDNA pool.

CD200R1 protein expression was analyzed in control and LPS-treated (24 hours) mixed glial cultures and BV2 cells. For each experimental condition, 5 × 10⁵ cells were collected and labelled with 10 μg/mL of polyclonal goat anti-CD200R1 (R&D, Abingdon, UK) or goat immunoglobulin G (IgG) (isotype control) in PBS for 20 minutes. Cells were washed once in PBS and incubated with 1 μg/mL of donkey anti-goat ALEXA 488 secondary antibody (Molecular Probes) for 20 minutes. Cell viability was evaluated by incubation with 10 μg/mL propidium iodide (Molecular Probes). CD200R1 expression was analyzed with gating on live cells, using the BD FACSCalibur™ platform (BD, Franklin Lakes, NJ, USA).

qChIP was performed as described by Straccia et al. 18 with some modifications. Briefly, control and LPS-treated (4 hours) primary mixed glial cultures or BV2 cells were cross-linked with formaldehyde (1% vol/vol final concentration) and processed for chromatin extraction. Chromatin shearing resulted in fragments of 500 bp. An aliquot of chromatin sheared from each sample was separated as a loading control for the experiment (input). The rest of the sample was processed for chromatin immunoprecipitation (ChIP) using Dynabeads® protein A (Invitrogen) and 2 μg of polyclonal rabbit anti-C/EBPβ antibody (Santa Cruz Biotechnology) or rabbit IgG (Santa Cruz Biotechnology) as the negative control. DNA was isolated after the elimination of the protein from the immunoprecipitated samples. Input and ChIP samples were analyzed using real-time PCR and SYBR green (Bio-Rad). Three microliters of input DNA (diluted 1/50) and ChIP samples were amplified in triplicate in 96-well plates using the MyIQ Bio-Rad Real Time Detection System, as described in the section on quantitative real-time PCR. The C/EBPβ binding site in the IL-10 promoter was used as a positive control (Liu et al., 2003). Match-1.0 (public version, BioBase) and MatInspector (Genomatix) were used to identify C/EBPβ consensus sequences in the 5,000 bp region upstream from the ATG translation start site of the CD200R1 gene. The sequences for each amplified locus and the primers used are shown in Table 1. Samples were run for 45 cycles (95°C for 30 seconds, 62°C for one minute, and 72°C for 30 seconds). For details regarding data analysis see the section on quantitative real-time PCR.

Fifty microliters of Dynabeads® protein A (Invitrogen, No.100.01D) were washed three times in PBS with 0.02% Tween-20 and incubated for two hours at 4°C with 4 μg of polyclonal rabbit anti-C/EBPβ (Santa Cruz Biotechnology), or with 4 μg of rabbit IgG (Santa Cruz Biotechnology) as negative control. Two hundred micrograms of protein obtained from chromatin extracts from control and LPS-treated (six hours) mixed glial cultures, as described above in the qChIP protocol, were incubated overnight with the antibody-Dynabeads® complex at 40 rpm on a rotating wheel at 4°C. The immuno complexes were pelleted using a magnetic rack and washed three times with PBS. Beads were removed from the samples by boiling in sample buffer (120 mM Tris HCl pH 6.8, 10% glycerol, 3% SDS, 20 mM DTT, and 0.4% bromophenol blue) for five minutes. Input (1/5 dilution) and immunoprecipitated samples were subjected to SDS-PAGE on a 10% polyacrylamide minigel. Western blot analysis was conducted as described above using monoclonal anti-HDAC1 antibody (1:2500, clone 2E10, Millipore) and monoclonal mouse anti-C/EBPβ antibody (1:500, Abcam). Samples immunoprecipitated with isotype-Dynabeads® or incubated with unlabeled beads were used as negative controls to demonstrate the specificity of the signal obtained.

The results are presented as the means + standard error of the mean (SEM). Statistical analyses were performed using one-way or two-way analysis of variance (ANOVA) followed by the Bonferroni post-test when three or more experimental groups were compared. Student’s t-test was used to compare two experimental groups. Values of P <0.05 were considered statistically significant.

CD200R1 expression was determined by immunocytochemistry in primary microglial cells in basal conditions and 12, 24 and 48 hours after LPS treatment. CD200R1 immunolabeling was observed in control primary microglial cells, defining the shape of the cells (Figure 1A). No differences in immunolabeling were observed between control and treated microglia 12 hours after LPS (Figure 1B); however, a marked decrease in labeling was observed 24 hours post-treatment (Figure 1C), and was still present at 48 hours (Figure 1D). CD200R1 immunocytochemistry was also evaluated in control and LPS-treated primary mixed glial cultures, composed of astrocytes and microglia. Basal expression of CD200R1 was observed in control cultures (Figure 2A, C and D). CD200R1 immunolabeling in the primary mixed glial cultures was localized in microglial (Figure 2C, E, G and I) but not in astroglial cells (Figure 2D, F, H and J). LPS treatment resulted in a decrease in CD200R1 labeling in the microglial cells (Figure 2B). These results were confirmed at the level of mRNA expression (Figure 3A). Basal expression of CD200R1 mRNA was observed in control primary microglial cultures and a decrease was observed in LPS-treated cultures. No significant CD200R1 mRNA expression was detected in astroglia-enriched cultures. We also detected a decrease in CD200R1 protein expression in LPS-treated primary mixed glial cultures via flow cytometry (Figure 3B).

To test whether C/EBPβ plays a role in the transcriptional regulation of CD200R1, we analyzed CD200R1 mRNA expression in control and LPS-treated primary mixed glial cultures of wild-type and C/EBPβ-deficient mice using quantitative real-time PCR. We first confirmed that C/EBPβ protein expression was basally detected in wild-type mixed glial cultures and increased after LPS treatment, but was absent in C/EBPβ-deficient cultures (Figure 4A). CD200R1 mRNA expression was significantly lower in wild-type cultures six hours after LPS treatment (Figure 4B). However, this decrease was not observed in LPS-treated C/EBPβ-deficient cultures. This effect occurred without any alteration in CD200R1 mRNA expression in basal conditions in the absence of C/EBPβ.

In order to evaluate whether an increase in the expression of C/EBPβ was sufficient to inhibit CD200R1 gene transcription in microglial cells, we overexpressed C/EBPβ in BV2 cells. We first confirmed the expression of CD200R1 in BV2 cells, and a decrease in this expression after LPS treatment (Figure 5A). We then prepared stable clones of BV2 overexpressing the C/EBPβ LAP isoform (BV2-LAP cells), the most abundant C/EBPβ isoform in glial cells. C/EBPβ overexpression was tested using qRT-PCR and western blot, and significant increases in C/EBPβ mRNA (Figure 5B) and C/EBPβ LAP protein (Figure 5C) were observed in control BV2-LAP cells in comparison to BV2-pCDNA clones (no LAP overexpression). LPS treatment increased C/EBPβ expression in both BV2-pCDNA and BV2-LAP cells.

C/EBPβ overexpression resulted in a significant decrease in CD200R1 mRNA in untreated BV2-LAP cells in comparison to untreated BV2-pCDNA cells (Figure 6A). LPS induced a significant decrease in CD200R1 mRNA in both types of clones. A decrease in CD200R1 protein was also observed in BV2-LAP cells versus BV2-pCDNA cells in untreated cultures via flow cytometry (Figure 6B-D). A significant decrease in both the number of cells expressing CD200R1 and the levels of CD200R1 expression was detected in control BV2-LAP cells versus BV2-pCDNA cells.

We next studied whether the effect of C/EBPβ on CD200R1 regulation was due to a direct interaction with the gene promoter. We first analyzed the 5,000 bp region upstream from the translation start site of the CD200R1 gene using the bioinformatic softwares Match-1.0 (public version, BioBase) and MatInspector (Genomatix), looking for putative C/EBPβ binding sites. Six putative binding sites (herein referred to as box 1 to 6) were identified, the positions and sequences of which are indicated in Table 1.We then investigated whether C/EBPβ could bind to these sites in a qChIP assay using primary mixed glial cultures. Due to their proximity to each other (less than 500 bp apart), it was impossible to distinguish binding to box 1 and 2 or to box 3 and 4 using our experimental approach. We did not detect any C/EBPβ binding to the CD200R1 gene promoter in untreated primary mixed glial cultures. However, significant binding of C/EBPβ to the CD200R1 gene promoter was observed after LPS-treatment, but only at the binding site closest to the ATG translation start site (box 6) (Figure 7A).

Using our BV2 cell clones, we also assessed whether C/EBPβ overexpression resulted in increased binding of the transcription factor to the CD200R1 gene promoter. As in mixed glial cultures, significant C/EBPβ binding to the CD200R1 gene promoter in BV2-pCDNA cells was only detected after LPS treatment, at the binding site closest to the ATG translation start site (Figure 7B). Nevertheless, significant C/EBPβ binding at the same site was observed in untreated BV2-LAP cells. No differences in C/EBPβ binding were observed between control and LPS-treated BV2-LAP cells.

To further elucidate the mechanism that underlies the C/EBPβ-mediated inhibition of CD200R1 transcription in microglial cells, we analyzed the possible involvement of histone deacetylases. HDAC1 may mediate the effect of C/EBPβ, given the role of this enzyme in histone modifications linked to gene expression inactivation. Using co-immunoprecipitation, we found that HDAC1 interacts with C/EBPβ mixed glial cultures treated with LPS for six hours (Figure 8A). We then analyzed whether HDAC1 was present in box 6 in the CD200R1 promoter using the qChIP assay. We detected binding of HDAC1 in LPS-treated mixed glial cultures (Figure 8B), suggesting that HDAC1 could interact with C/EBPβ to control CD200R1 transcription. Finally, we also investigated whether HDAC1 could play an active role in the transcription of CD200R1, using the HDAC inhibitors SAHA and MS-275. We observed that the inhibition of CD200R1 mRNA expression detected in mixed glial cultures after LPS treatment was partially reverted by both HDAC inhibitors (Figure 8B and C).